Help icon

Detection Image Detection method details

Name:

QL-ELE-cat-F2/cat-R2

Description:

Qualitative conventional PCR method for detection of the full-length chloramphenicol marker that is frequently harboured by GMM in food enzyme preparations (Fraiture et al. 2020).

In detail, the potential presence of the chloramphenicol marker is first screened using a real-time PCR method (see Related Methods QL-ELE-cat-F/R). In case a positive real-time PCR signal is obtained, the presence of the full-length chloramphenicol marker is then evaluated by a nested-PCR consisting of the related method QL-ELE-cat-F1/cat-R1 and this method.

Comment:

Target is the chloramphenicol acetyl-transferase (cat) gene conferring resistance to chloramphenicol (CmR).

For the nested PCR the majority of the chloramphenicol marker sequence is amplified using the primer pair cat-F1/cat-R1 (see Related Methods). A 1:100 dilution of the generated PCR product is then submitted to a second PCR reaction using the primer pair cat-F2/cat-R2 (this method) in order to increase the specific amplicon yield.

Validation:

unknown

Standardisation:

none

Related Methods:

QL-ELE-cat-F/R, QL-ELE-cat-F1/R1

Type:

element-specific

Target DNA element:

V-chloramphenicol acetyl transferase
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cat-F2
  • Sequence:

    CCAACAAACGACTTTTAGTATAACC
  • Size:

    25
  • Reverse Primer

  • Name:

    cat-R2
  • Sequence:

    TCCTGCATGATAACCATCAC
  • Size:

    20
  • Amplicon:

  • Sequence:

    CCAACAAACGACTTTTAGTATAACCACAGAAATTGATATTAGTGTTTTATACCGAAACATAAAACAAGAAGGATATAAATTTTACCGTGCATTTATTTTCTTAGTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAATAGCGACGGAGAGTTAGGTTATTGGGATAAGTTAGAGCCACTTTATACAATTTTTGATGGTGTATCTAAAACATTCTCTGGTATTTGGACTCCTGTAAAGAATGACTTCAAAGAGTTTTATGATTTATACCTTTCTGATGTAGAGAAATATAATGGTTCGGGGAAATTGTTTCCCAAAACACCTATACCTGAAAATGCTTTTTCTCTTTCTATTATTCCATGGACTTCATTTACTGGGTTTAACTTAAATATCAATAATAATAGTAATTACCTTCTACCCATTATTACAGCAGGAAAATTCATTAATAAAGGTAATTCAATATATTTACCGCTATCTTTACAGGTACATCATTCTGTTTGTGATGGTTATCATGCAGGA
  • Size:

    529

Documents

Citation Type Local copy
Fraiture MA, Deckers M, Papazova N, Roosens NHC (2020) Detection strategy targeting a chloramphenicol resistance gene from genetically modified bacteria in food and feed products. Food Control. 108:106873Link to the document url. peer-reviewed article 15-01-2020