Help icon

Detection Image Detection method details

Name:

QL-ELE-cat-F1/R1

Description:

Qualitative conventional PCR for detection of the full-length Chloramphenicol marker gene that is frequently harboured by GMM in food enzyme preparations (Fraiture et al. 2020).

In detail, the potential presence of the chloramphenicol marker is first screened using a real-time PCR method (Turgeon, Laflamme, Ho, & Duchaine, 2008)(see Related Methods QL-ELE-cat-F/R). In case a positive real-time PCR signal is obtained, the presence of the full-length chloramphenicol marker is then evaluated by a nested-PCR consisting of this method and the related method QL-ELE-cat-F2/R2.

Comment:

Target is the chloramphenicol acetyl-transferase (cat) gene conferring resistance to chloramphenicol (CmR)

For the nested PCR the majority of the chloramphenicol marker sequence is amplified using the primer pair cat-F1/R1 (this method). A 1:100 dilution of the generated PCR product is then submitted to a second PCR reaction using the primer pair cat-F2/R2 (see Related Methods QL-ELE-cat-F2/R2) in order to increase the specific amplicon yield.

Validation:

unknown

Standardisation:

none

Related Methods:

QL-ELE-cat-F/R, QL-ELE-cat-F2/cat-R2

Type:

element-specific

Target DNA element:

V-chloramphenicol acetyl transferase
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cat-F1
  • Sequence:

    TTTGAACCAACAAACGACTTT
  • Size:

    21
  • Reverse Primer

  • Name:

    cat-R1
  • Sequence:

    GGCCTATCTGACAATTCCTGA
  • Size:

    21
  • Amplicon:

  • Sequence:

    TTTGAACCAACAAACGACTTTTAGTATAACCACAGAAATTGATATTAGTGTTTTATACCGAAACATAAAACAAGAAGGATATAAATTTTACCGTGCATTTATTTTCTTAGTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAATAGCGACGGAGAGTTAGGTTATTGGGATAAGTTAGAGCCACTTTATACAATTTTTGATGGTGTATCTAAAACATTCTCTGGTATTTGGACTCCTGTAAAGAATGACTTCAAAGAGTTTTATGATTTATACCTTTCTGATGTAGAGAAATATAATGGTTCGGGGAAATTGTTTCCCAAAACACCTATACCTGAAAATGCTTTTTCTCTTTCTATTATTCCATGGACTTCATTTACTGGGTTTAACTTAAATATCAATAATAATAGTAATTACCTTCTACCCATTATTACAGCAGGAAAATTCATTAATAAAGGTAATTCAATATATTTACCGCTATCTTTACAGGTACATCATTCTGTTTGTGATGGTTATCATGCAGGATTGTTTATGAACTCTATTCAGGAATTGTCAGATAGGCC
  • Size:

    573

Documents

Citation Type Local copy
Fraiture MA, Deckers M, Papazova N, Roosens NHC (2020) Detection strategy targeting a chloramphenicol resistance gene from genetically modified bacteria in food and feed products. Food Control. 108:106873Link to the document url. peer-reviewed article 15-01-2020