Help icon

Detection Image Detection method details

Name:

QL-ELE-cat-F/R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the chloramphenicol marker potentially harboured by GMM in food enzyme preparations (Turgeon et al. 2008).

In term of food and feed safety, to evaluate the level of risks of likely AMR (antimicrobial resistance) gene acquisition by pathogens and gut microbiota, it is essential to determine if the full-length AMR genes are present. In order to assess the presence of the full-length cat gene a successive nested-PCR method can be performed to amplify a large fragment of the cat gene be performed (Fraiture et al. 2020) (see Related Methods QL-ELE-cat-F1/R1 and QL-ELE-cat-F2/R2).

Comment:

Target is the chloramphenicol acetyl-transferase (cat) gene conferring resistance to chloramphenicol (CmR).

Validation:

unknown

Standardisation:

none

Related Methods:

QL-ELE-cat-F1/R1, QL-ELE-cat-F2/cat-R2

Type:

element-specific

Target DNA element:

V-chloramphenicol acetyl transferase
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cat-F
  • Sequence:

    GTGACAAGGGTGATAAACTCAAATAC
  • Size:

    26
  • Reverse Primer

  • Name:

    cat-R
  • Sequence:

    TGTATAAAGTGGCTCTAACTTATCCC
  • Size:

    26
  • Probe

  • Name:

    cat-P
  • Sequence:

    ACCTAACTCTCCGTCGCTATTGTAACCAGT
  • Size:

    30
  • Amplicon:

  • Sequence:

    GTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAATAGCGACGGAGAGTTAGGTTATTGGGATAAGTTAGAGCCACTTTATACA
  • Size:

    96

Documents

Citation Type Local copy
Turgeon N, Laflamme C, Ho J (2008) Evaluation of the plasmid copy number in B. cereus spores, during germination, bacterial growth and sporulation using real-time PCR. Plasmid. 60(2):118-24Link to the document url. peer-reviewed article 15-01-2020pdf