Help icon

Detection Image Detection method details

Name:

QT-EVE-GH-011

Description:

Quantitative PCR method for detection of cotton event DAS81910 (EURL GMFF GMOMETHODS database as of January 10, 2019)

Comment:

Target is the 5' integration border region (IBR) between the insert of cotton event DAS81910 and the cotton host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GH-016, QT-TAX-GH-021

Type:

event-specific

Target GMO name:

DAS81910
  • Oligonucleotides:

  • Forward Primer

  • Name:

    1706-f2
  • Sequence:

    AAGCTTAGGTGATTTCGATGATG
  • Size:

    23
  • Reverse Primer

  • Name:

    1706-r3
  • Sequence:

    GACCTCAATTGCGAGCTTTC
  • Size:

    20
  • Probe

  • Name:

    1706-p3
  • Sequence:

    CACACCAAAAGTTAGGCCCG
  • Size:

    20
  • Amplicon:

  • Sequence:

    aagcttaggt gatttcgatg atgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnncacac caaaagttag gcccgnnnnn nnnnnnnnnn gaaagctcgc aattgaggtc
  • Size:

    120

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-GH-011Link to the document url. EU reference method protocol 10-01-2020