Help icon

Detection Image Detection method details

Name:

QT-TAX-ZM-005

Description:

Quantitative PCR method for detection of maize high-mobility-group (hmg) gene (EU-RL GMFF GMOMETHODS database as of May 28, 2018).

Comment:

Target the high-mobility-group (hmg) gene from Zea mays

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ZM1-F
  • Sequence:

    TTGGACTAGAAATCTCGTGCTGA
  • Size:

    23
  • Reverse Primer

  • Name:

    ZM1-R
  • Sequence:

    GCTACATAGGGAGCCTTGTCCT
  • Size:

    22
  • Probe

  • Name:

    PHN149436
  • Sequence:

    CAATCCACACAAACGC
  • Size:

    16
  • Amplicon:

  • Sequence:

    ttggactaga aatctcgtgc tgannnnnnn nnnnnnnnnn gcgtttgtgt ggattgnagg acaaggctcc ctatgtagc
  • Size:

    79

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-ZM-005Link to the document url. EU reference method protocol 28-05-2018