Help icon

Detection Image Detection method details

Name:

QT-TAX-ZM-004

Description:

Quantitative real-time PCR (TaqMan) for detection of maize aldolase 1 (ald1) gene (EU-RL GMFF GMOMETHODS database as of July 14, 2016).

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 2

Comment:

Target the aldolase 1 (ald1) gene from Zea mays.

This assay is NOT recommended for GMO quantitative analysis because of a secondary target with mismatches in the primers and probe annealing region.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Aldolase primer F
  • Sequence:

    AGGGAGGACGCCTCCCT
  • Size:

    17
  • Reverse Primer

  • Name:

    Aldolase primer R
  • Sequence:

    ACCCTGTACCAGAAGACCAAGG
  • Size:

    22
  • Probe

  • Name:

    Aldolase probe
  • Sequence:

    TGAGGACATCAACAAAAGGCTTGCCA
  • Size:

    26
  • Amplicon:

  • Sequence:

    agggaggacgcctccctccttgaggacatcaacaaaaggcttgccatccttggtcttctggtacagggt
  • Size:

    69

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018
EU-RL GMFF GMOMETHODS database; QL-TAX-ZM-004Link to the document url. EU reference method protocol 01-11-2018