Help icon

Detection Image Detection method details

Name:

QT-TAX-ZM-003

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize alcohol dehydrogenase 1 (adh1) gene (EU-RL GMFF GMOMETHODS database as of October 01, 2014)

Comment:

Target is the alcohol dehydrogenase 1 (adh1) gene from Zea mays

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ADH-FF3
  • Sequence:

    cgtcgtttcccatctcttcctcct
  • Size:

    24
  • Reverse Primer

  • Name:

    ADH-RR4
  • Sequence:

    ccactccgagaccctcagtc
  • Size:

    20
  • Probe

  • Name:

    ADH1-MDO
  • Sequence:

    aatcagggctcattttctcgctcctca
  • Size:

    27
  • Amplicon:

  • Sequence:

    cgtcgtttcccatctcttcctcctttagagctaccactatataaatcagggctcattttctcgctcctcacaggctcatctcgctttggatcgattggtttcgtaactggtgaaggactgagggtctcggagtgg
  • Size:

    135

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-ZM-003Link to the document url. EU reference method protocol