Help icon

Detection Image Detection method details

Name:

QT-TAX-SAD-FW/SAD-RV

Description:

Quantitative real-time PCR (TaqMan) method for detection of flax/linseed (GeneticID NA Inc, 2009; http://gmo-crl.jrc.ec.europa.eu/flax.htm).

Comment:

Target is the endogenous stearoyl-acyl carrier protein desaturase 2 (SAD) of Linum usitatissimum

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

taxon-specific

Target Species name:

Linum usitatissimum
  • Oligonucleotides:

  • Forward Primer

  • Name:

    SAD-FW
  • Sequence:

    GCTCAACCCAGTCACCACCT
  • Size:

    20
  • Reverse Primer

  • Name:

    SAD-RV
  • Sequence:

    TGCGAGGAGATCTGGAGGAG
  • Size:

    20
  • Probe

  • Name:

    SAD-probe
  • Sequence:

    TGTTGAGGGAGCGTGTTGAAGGGA
  • Size:

    24
  • Amplicon:

  • Sequence:

    GCTCAACCCAGTCACCACCTTCCCTTCAACACGCTCCCTCAACAACTTCTCCTCCAGATCTCCTCGCA
  • Size:

    69

Documents

Citation Type Local copy