Help icon

Detection Image Detection method details

Name:

QT-TAX-OS-017

Description:

Quantitative real-time PCR (TaqMan) method for the detection of rice phospholipase D alpha 2 (PLD) gene (EU-RL GMFF GMOMETHODS database as of January 13, 2014)

Comment:

Target is the phospholipase D (PLD) gene from Oryza sativa

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Oryza sativa
  • Oligonucleotides:

  • Forward Primer

  • Name:

    KVM159
  • Sequence:

    TGGTGAGCGTTTTGCAGTCT
  • Size:

    20
  • Reverse Primer

  • Name:

    KVM160
  • Sequence:

    CTGATCCACTAGCAGGAGGTCC
  • Size:

    22
  • Probe

  • Name:

    TM013
  • Sequence:

    TGTTGTGCTGCCAATGTGGCCTG
  • Size:

    23
  • Amplicon:

  • Sequence:

    tggtgagcgttttgcagtctntgttgtgctgccaatgtggcctgnnggacctcctgctagtggatcag
  • Size:

    68

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-TAX-OS-017Link to the document url. EU reference method protocol