Help icon

Detection Image Detection method details

Name:

QT-TAX-GH-021

Description:

Quantitative real-time PCR (TaqMan) method for detection of putative cotton SAH7 protein gene (115bp) (EU-RL GMFF GMOMETHODS database as January 22, 2014).

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 2

Comment:

Target is the endogenous putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum

Copies of the SAH7 protein gene are coded on the A-subgenome and the D-subgenome of Gossypium hirsutum. Both are detected with the method QT-TAX-GH-021 but the respective amplicons differ in length (A-subgenome: 115 bp, D-subgenome: 123 bp).

The assay for AdhC should be preferred for GMO quantitative analysis, but SAH7 can also be used because primers and probe anneal without mismatches to both target DNAs.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Gossypium hirsutum
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Sah7-uni-f1
  • Sequence:

    AGTTTGTAGGTTTTGATGTTACATTGAG
  • Size:

    28
  • Reverse Primer

  • Name:

    Sah7-uni-r1
  • Sequence:

    GCATCTTTGAACCGCCTACTG
  • Size:

    21
  • Probe

  • Name:

    Sah7-uni-s1
  • Sequence:

    AAACATAAAATAATGGGAACAACCATGACATGT
  • Size:

    33
  • Amplicon:

  • Sequence:

    agtttgtaggttttgatgttacattgagnnnnnnnnnnnnnnnnnnnnnnnaaacataaaataatgggaacaaccatgacatgtnnnnnnnnnncagtaggcggttcaaagatgc
  • Size:

    115

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018
EU-RL GMFF GMOMETHODS database; QT-TAX-GH-021Link to the document url. EU reference method protocol