Help icon

Detection Image Detection method details

Name:

QT-TAX-GH-016

Description:

Quantitative PCR method for detection of putative cotton SAH7 protein gene (123 bp) (Mazzara et al., 2006).

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 2

Comment:

Target is the IVS of the putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum D-subgenome.

The assay for AdhC should be preferred for GMO quantitative analysis, but SAH7 can also be used because primers and probe anneal without mismatches to both target DNAs.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Gossypium hirsutum
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Sah7-uni-f1
  • Sequence:

    AGTTTGTAGGTTTTGATGTTACATTGAG
  • Size:

    28
  • Reverse Primer

  • Name:

    Sah7-uni-r1
  • Sequence:

    GCATCTTTGAACCGCCTACTG
  • Size:

    21
  • Probe

  • Name:

    Sah7-uni-s1
  • Sequence:

    AAACATAAAATAATGGGAACAACCATGACATGT
  • Size:

    33
  • Amplicon:

  • Sequence:

    agtttgtaggttttgatgttacattgagnnnnnnnnnnnnnnnnnnnnnnnaaacataaaataatgggaacaaccatgacatgtnnnnnnnnnnnnnnnnnncagtaggcggttcaaagatgc
  • Size:

    123

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018
EU-RL GMFF GMOMETHODS database; QT-TAX-GH-016Link to the document url. EU reference method protocol