Help icon

Detection Image Detection method details

Name:

QT-TAX-BN-002

Description:

Quantitative real-time PCR (TaqMan) method for detection of oilseed rape cruciferin storage protein (EU-RL GMFF GMOMETHODS database as of January 27, 2014).

Estimated number of target copies per haploid genome (Jacchia et al. 2018): 4

Comment:

Target is the endogenous cruciferin storage protein (BnC1) gene from Brassica napus.

This assay is NOT recommended for GMO quantitative analysis because of a secondary target with mismatches in the primers and probe annealing region.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

taxon-specific

Target Species name:

Brassica napus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ccf R
  • Sequence:

    GCTTCCGTGATATGCACCAGAAAG
  • Size:

    24
  • Reverse Primer

  • Name:

    ccf F
  • Sequence:

    ATTGGGCTACACCGGGATGTGT
  • Size:

    22
  • Probe

  • Name:

    ccf P
  • Sequence:

    CGATGGTGTCCCCAGTCCTTATGTGCTC
  • Size:

    28
  • Amplicon:

  • Sequence:

    gcttccgtgatatgcaccagaaagnngagcacataaggactggggacaccatcgnnacacatcccggtgtagcccaat
  • Size:

    78

Documents

Citation Type Local copy
Jacchia S., Kagkli D.F., Lievens A., Angers-Loustau A., Savini C., Emons H., Mazzara M. (2018) Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 93,191-200Link to the document url. peer-reviewed article 31-10-2018
EU-RL GMFF GMOMETHODS database; QT-TAX-BN-002Link to the document url. EU reference method protocol