Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-029

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event MON87419 (EU-RL GMFF GMOMETHODS database as of September 23, 2019)

Comment:

Target is the 5' integration border region (IBR) between the insert of maize event MON87419 and the maize host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-002

Type:

event-specific

Target GMO name:

MON87419
  • Oligonucleotides:

  • Forward Primer

  • Name:

    87419 QF
  • Sequence:

    CGGTCGCTGCCAGGTATTG
  • Size:

    19
  • Reverse Primer

  • Name:

    87419 QR
  • Sequence:

    CAGACCTCAATTGCGAGCTTTCT
  • Size:

    23
  • Probe

  • Name:

    87419 QP
  • Sequence:

    TGTGCGCCAGTCAGCATCATCACACC
  • Size:

    26
  • Amplicon:

  • Sequence:

    CGGTCGCTGCCAGGTATTGATGTGCGCCAGTCAGCATCATCACACCAAAAGTTAGGCCCGAATAGTTTGAAATTAGAAAGCTCGCAATTGAGGTCTG
  • Size:

    97

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-029Link to the document url. EU reference method protocol 25-09-2019