Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-028

Description:

Quantitative real-time PCR (TaqMan) method for detection of MZIR098. (EURL GMFF GMOMETHODS database as of 2018).

Comment:

Target is the 5' integration border region (IBR) between the insert of maize event MZIR098 and the maize host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-014

Type:

event-specific

Target GMO name:

MZIR098
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MZIR098 forward primer
  • Sequence:

    ATCTCAGACACCAAACCGAGATC
  • Size:

    23
  • Reverse Primer

  • Name:

    MZIR098 reverse primer
  • Sequence:

    ACACCGTTAGGCTAGTGCCAGT
  • Size:

    22
  • Probe

  • Name:

    MZIR098 probe
  • Sequence:

    CAAGTGACAGCGAACGGAGCTGGTTT
  • Size:

    26
  • Amplicon:

  • Sequence:

    atctcagacaccaaaccgagatccaagtgacagcgaacggagctggtttnnactggcactagcctaacggtgt
  • Size:

    73

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-028Link to the document url. EU reference method protocol 08-01-2019