Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-027

Description:

Quantitative real-time PCR (TaqMan) method for detection of MZHG0JG. (EURL GMFF GMOMETHODS database as of 2018).

Comment:

Target is the 3' integration border region (IBR) between the insert of maize event MZHG0JG and the maize host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-014

Type:

event-specific

Target GMO name:

MZHG0JG
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MZHG0JG forward primer
  • Sequence:

    CAACTAGCTAGATTAATTAACGCAATCTG
  • Size:

    29
  • Reverse Primer

  • Name:

    MZHG0JG reverse primer
  • Sequence:

    ATTTGTTTGCAAGGTGTGGGA
  • Size:

    21
  • Probe

  • Name:

    MZHG0JG probe
  • Sequence:

    TTAAGTTGTCTAAGCGTCAATTTG
  • Size:

    24
  • Amplicon:

  • Sequence:

    caactagctagattaattaacgcaatctgnnnttaagttgtctaagcgtcaatttgnnnntcccacaccttgcaaacaaat
  • Size:

    81

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-027Link to the document url. EU reference method protocol 27-08-2018