Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-026

Description:

Quantitative PCR method for detection of maize event 4114 (EURL GMFF GMOMETHODS database, as of May 24, 2018).

Comment:

Target is the 5' integration border region (IBR) between the insert of maize event 4114 and the maize host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-005

Type:

event-specific

Target GMO name:

4114
  • Oligonucleotides:

  • Forward Primer

  • Name:

    PHN164689
  • Sequence:

    GCTTTGGAGCCTCTCGTTTGTA
  • Size:

    22
  • Reverse Primer

  • Name:

    PHN164690
  • Sequence:

    GCGTTTAAACTATCAGATCTGTGTTGAA
  • Size:

    28
  • Probe

  • Name:

    PHN164691
  • Sequence:

    CACTTGCACGTAGTTACCCGGACCGAA
  • Size:

    27
  • Amplicon:

  • Sequence:

    gctttggagcctctcgtttgtancacttgcacgtagttacccggaccgaannttcaacacagatctgatagtttaaacgc
  • Size:

    80

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-026Link to the document url. EU reference method protocol 28-05-2018