Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-024

Description:

Quantitative PCR method for detection of maize event MON87411 (EURL GMFF GMOMETHODS database, as of April 21, 2017)

Comment:

Target is the 3' integration border region (IBR) between the insert of maize event MON87411 and the maize host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-ZM-002

Type:

event-specific

Target GMO name:

MON87411
  • Oligonucleotides:

  • Forward Primer

  • Name:

    87411 QF
  • Sequence:

    CTCTGTAACAGAAAACACCATCTAGAG
  • Size:

    27
  • Reverse Primer

  • Name:

    87411 QR
  • Sequence:

    ACAAAAGTGAACTAGTTCTAGGGTAGAT
  • Size:

    28
  • Probe

  • Name:

    87411 QP
  • Sequence:

    CCGCGTTTAAACTATCAGTGTTTAGAGAAT
  • Size:

    30
  • Amplicon:

  • Sequence:

    ctctgtaaca gaaaacacca tctagagnnn ccgcgtttaa actatcagtg tttagagaat nnnnnnnnnn nnnnnnnnnn natctaccct agaactagtt cacttttgt
  • Size:

    109

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-024Link to the document url. EU reference method protocol 09-05-2018