Help icon

Detection Image Detection method details

Name:

QT-EVE-ZM-002

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event 5307 (EURL GMFF GMOMETHODS database as of 2014).

Comment:

Target is the 3' integration border region (IBR) between the insert of maize event 5307 and the maize host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

event-specific

Target GMO name:

5307
  • Oligonucleotides:

  • Forward Primer

  • Name:

    5307i3' forward primer
  • Sequence:

    CATGGCCGTATCCGCAATGTG
  • Size:

    21
  • Reverse Primer

  • Name:

    5307i3' reverse primer
  • Sequence:

    TGCACCCTTTGCCAGTGG
  • Size:

    18
  • Probe

  • Name:

    5307i3'-s2 probe
  • Sequence:

    ACCACAATATACCCTCTTCCCTGGGCCAG
  • Size:

    29
  • Amplicon:

  • Sequence:

    catggccgtatccgcaatgtgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaccacaatataccctcttccctgggccagnnnnnnnccactggcaaagggtgca
  • Size:

    107

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-EVE-ZM-002Link to the document url. EU reference method protocol 15-12-2017