Help icon

Detection Image Detection method details

Name:

QT-EVE-OS-G6H1-F/G6H1-R

Description:

Quantitative real-time PCR (TaqMan) method for detection of rice event G6H1

Comment:

Target is the 3' integration border region (IBR) between the insert of rice event G6H1 and the rice host genome

Validation:

ring trial validation

Standardisation:

Related Methods:

QT-TAX-SPS primer f/SPS primer r

Type:

event-specific

Target GMO name:

G6H1
  • Oligonucleotides:

  • Forward Primer

  • Name:

    G6H1-F
  • Sequence:

    AAGCGTCAATTTGTTTACACC
  • Size:

    21
  • Reverse Primer

  • Name:

    G6H1-R
  • Sequence:

    TCGATCTGCTGCAGCTTG
  • Size:

    18
  • Probe

  • Name:

    G6H1-P
  • Sequence:

    ATGGATGTATCGCCACCAGCACC
  • Size:

    23
  • Amplicon:

  • Sequence:

    aagcgtcaatttgtttacaccacaaagaaaaagatgatggatcgatggatgtatcgccaccagcaccggcaccaagctgcagcagatcga
  • Size:

    90

Documents

Citation Type Local copy