Help icon

Detection Image Detection method details

Name:

QT-EVE-HF-1F/HF-2R

Description:

Quantitative real-time PCR (SYBRGreen) method for detection of tomato event Huafan No 1 (Yang et al., 2013)

Comment:

Target is the 3' integration border region (IBR) between the insert of tomato event Huafan No 1 and the tomato host genome.

The nucleotide sequence of 1639 bp used for the development of this event-specific PCR detection method is given in GenBank EU363226.

Validation:

in-house validation

Standardisation:

unknown

Related Methods:

QT-TAX-SL-002

Type:

event-specific

Target GMO name:

Huafan No 1
  • Oligonucleotides:

  • Forward Primer

  • Name:

    HF-1F
  • Sequence:

    CTGTTGCCCGTCTCACTG
  • Size:

    18
  • Reverse Primer

  • Name:

    HF-2R
  • Sequence:

    AATCGTGTATGACCTTTTAG
  • Size:

    20
  • Amplicon:

  • Sequence:

    ctgttgcccgtctcactggtgaaaagaaaaaccaccccagtacattaaaaacgtccgcaatgtgttattaagttaaatatataatgctattttatatattgttttaagttaaatatataataatattctccaaatggacatttaacttgactttttttatctattaaaattacttttcataacaattaaattataaacttgctaattcctaaaaggtcatacacgatt
  • Size:

    228

Documents

Citation Type Local copy
Yang, C., Zhang, D., Yang, L. (2013) Development of event-specific PCR detection methods for genetically modified tomato Huafan No. 1. J Sci Food Agric, 93(3), 652-60Link to the document url. peer-reviewed article 06-09-2018