Help icon

Detection Image Detection method details

Name:

QT-EVE-GM-017

Description:

Quantitative real-time PCR (TaqMan) method for detection of soybean event SYHT0H2(EU-RL GMFF GMOMETHODS database as of September 19, 2016)

Comment:

Target is the 3' integration border region (IBR) between the insert of soybean event SYHT0H2 and the soybean host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GM-002

Type:

event-specific

Target GMO name:

SYHT0H2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    FE08316-F
  • Sequence:

    GGGAATTGGGTACCATGCC
  • Size:

    19
  • Reverse Primer

  • Name:

    FE08317-R
  • Sequence:

    TGTGTGCCATTGGTTTAGGGT
  • Size:

    21
  • Probe

  • Name:

    FE08318-P
  • Sequence:

    CCAGCATGGCCGTATCCGCAA
  • Size:

    21
  • Amplicon:

  • Sequence:

    gggaattgggtaccatgccnnnnnnnccagcatggccgtatccgcaannnnnnnnnnnnnnnnnnnnaccctaaaccaatggcacaca
  • Size:

    88

Documents

Citation Type Local copy