Help icon

Detection Image Detection method details

Name:

QT-EVE-GM-016

Description:

Quantitative PCR method for detection of soybean event MON87751 (EURL GMFF GMOMETHODS database as of April 21, 2017)

Comment:

Target is the 5' integration border region (IBR) between the insert of soybean event MON87751 and the soybean host genome.

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GM-002

Type:

event-specific

Target GMO name:

MON87751
  • Oligonucleotides:

  • Forward Primer

  • Name:

    MON87751 primer 2
  • Sequence:

    CTAAATTGCTCTTTGGAGTTTATTTTGTAG
  • Size:

    30
  • Reverse Primer

  • Name:

    MON87751 primer 1
  • Sequence:

    GGCCTAACTTTTGGTGTGATGATG
  • Size:

    24
  • Probe

  • Name:

    MON87751 probe
  • Sequence:

    TGACTGGAGATCTCCAAAGTGAGGGGAAA
  • Size:

    29
  • Amplicon:

  • Sequence:

    ctaaattgct ctttggagtt tattttgtag nnntttcccc tcactttgga gatctccagt cancatcatc acaccaaaag ttaggcc
  • Size:

    87

Documents

Citation Type Local copy