Help icon

Detection Image Detection method details

Name:

QT-EVE-GM-014

Description:

Quantitative PCR method for detection of soybean event DAS-81419-2 (EURL GMFF GMOMETHODS database as of May 28, 2015)

Comment:

Target is the 5' integration border region (IBR) between the insert of soybean event DAS-81419-2 and the soybean host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-GM-002

Type:

event-specific

Target GMO name:

DAS81419
  • Oligonucleotides:

  • Forward Primer

  • Name:

    DAS81419-f2
  • Sequence:

    TCTAGCTATATTTAGCACTTGATATTCAT
  • Size:

    29
  • Reverse Primer

  • Name:

    DAS81419-r1
  • Sequence:

    GCTTCAAGATCCCAACTTGCG
  • Size:

    21
  • Probe

  • Name:

    DAS81419-p3
  • Sequence:

    ATCAACAGGCACCGATGCGCACCG
  • Size:

    24
  • Amplicon:

  • Sequence:

    tctagctatatttagcacttgatattcatnnnnnnnnnnnnnnnnnnnnn nnnnnncggtgcgcatcggtgcctgttgatnnnncgcaagttgggatcttgaagc
  • Size:

    105

Documents

Citation Type Local copy