Help icon

Detection Image Detection method details

Name:

QT-EVE-CP-001

Description:

Quantitative real-time (TaqMan) PCR method for detection of papaya event Huanong No. 1 (EU-RL GMFF GMOMETHODS database as of September 13, 2016)

Comment:

Target is the 5' integration border region (IBR) between the insert of papaya event Huanong No 1 and the papaya host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QT-TAX-CP-001

Type:

event-specific

Target GMO name:

Huanong No. 1
  • Oligonucleotides:

  • Forward Primer

  • Name:

    qHN-F
  • Sequence:

    gacgagtacaaggagacgcc
  • Size:

    20
  • Reverse Primer

  • Name:

    qHN-R
  • Sequence:

    gttgtcactgaagcgggaag
  • Size:

    20
  • Probe

  • Name:

    qHN-P
  • Sequence:

    tggctgctattgggcgaatcaactac
  • Size:

    26
  • Amplicon:

  • Sequence:

    gacgagtacaaggagacgccttttaatttgtttaaattaaataaaaacataaattattaagcgacgtaataataaacacgtcataaattttttcaaaaaataaaatttcttttattttctaaaaagtagttgattcgcccaatagcagccagtcccttcccgcttcagtgacaac
  • Size:

    175

Documents

Citation Type Local copy
Guo, J. C., Yang, L. T., Liu, X., Guan, X. Y., Jiang, L. X., & Zhang, D. B. (2009). Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong no. 1 papaya. Journal of Agricultural and Food Chemistry, 57(16), 7205-7212.Link to the document url. peer-reviewed article 10-10-2016
Wei, J. et al. (2016). Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1. Food Chemistry, 194, 20-25.Link to the document url. peer-reviewed article 14-10-2016