Help icon

Detection Image Detection method details

Name:

QT-ELE-00-004

Description:

Quantitative real-time PCR (TaqMan) method for detection of Cauliflower mosaic virus 35S promoter (ISO 21570 Annex B.1)

Comment:

the target is the 35S promoter (P-35S) from Cauliflower mosaic virus

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

Type:

element-specific

Target DNA element:

E-35S-CaMV, P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    35S-F
  • Sequence:

    gcctctgccgacagtggt
  • Size:

    18
  • Reverse Primer

  • Name:

    35S-R
  • Sequence:

    aagacgtggttggaacgtcttc
  • Size:

    22
  • Probe

  • Name:

    35S-TMP
  • Sequence:

    caaagatggacccccacccacg
  • Size:

    22
  • Amplicon:

  • Sequence:

    gcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtctt
  • Size:

    82

Documents

Citation Type Local copy
ISO21570:2005(E) Annex B (informative)Link to the document url. EU reference method protocol 30-03-2012
EU-RL GMFF GMOMETHODS database; QT-ELE-00-004Link to the document url. EU reference method protocol