Help icon

Detection Image Detection method details

Name:

QT-ELE-00-001

Description:

Quantitative real-time PCR (TaqMan) method for detection of Cauliflower mosaic virus 35S promoter (Feinberg et al., 2005)

Comment:

Target is the Cauliflower mosaic virus 35S promoter (CaMV P-35S)

Validation:

ring trial validation

Standardisation:

unknown

Related Methods:

Type:

element-specific

Target DNA element:

P-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    sF
  • Sequence:

    CGTCTTCAAAGCAAGTGGATTG
  • Size:

    22
  • Reverse Primer

  • Name:

    sR
  • Sequence:

    TCTTGCGAAGGATAGTGGGATT
  • Size:

    22
  • Probe

  • Name:

    35S core
  • Sequence:

    TCTCCACTGACGTAAGGGATGACGCA
  • Size:

    26
  • Amplicon:

  • Sequence:

    cgtcttcaaagcaagtggattgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatcccactatccttcgcaaga
  • Size:

    79

Documents

Citation Type Local copy
Feinberg M., Fernandez S., Cassard S., Bertheau Y.; Quantitation of 35S promoter in maize DNA extracts from genetically modified organisms using real-time polymerase chain reaction, part 2: interlaboratory study J AOAC Int 88:558-573 (2005)Link to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QT-ELE-00-001Link to the document url. EU reference method protocol