Help icon

Detection Image Detection method details

Name:

QT-CON-00-005

Description:

Quantitative real-time PCR (TaqMan) method for detection of maize event T25 (Shindo et al., 2002)

Comment:

Target is the junction region between the phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes and the Cauliflower Mosaic Virus 35S terminator (CaMV T-35S)

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QT-TAX-ZM-006

Type:

construct-specific

Target GMO names:

32316, 40416, 4114, 676, 678, 680, A2704-12, A2704-21, A5547-127, A5547-35, DAS1507, DAS59122, DAS59132, Falcon GS 40/90, GU262, HCN10, HCR-1, Liberator, T120-7, T14, T25, T45, Topas 19/2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T25 1-5'
  • Sequence:

    GCCAGTTAGGCCAGTTACCCA
  • Size:

    21
  • Reverse Primer

  • Name:

    T25 1-3'
  • Sequence:

    TGAGCGAAACCCTATAAGAACCCT
  • Size:

    24
  • Probe

  • Name:

    T25-2-Taq
  • Sequence:

    TGCAGGCATGCCCGCTGAAATC
  • Size:

    22
  • Amplicon:

  • Sequence:

    gccagttaggccagttacccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagggttcttatagggtttcgctca
  • Size:

    149

Documents

Citation Type Local copy
Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., Akiyama H., Goda Y., Toyoda M., Hino A.; Validation of real-time PCR analyses for line-specific quantitation of genetically modified maize and soybean using new reference molecules J AOALink to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QT-CON-00-005Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document