Help icon

Detection Image Detection method details

Name:

QT-CON-00-003

Description:

Quantitative real-time PCR (TaqMan) method for detection of soybean event GTS-40-3-2 (ISO/FDIS 21570).

Comment:

Target is the junction region between the Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) and the chloroplast transit peptide (CTP) sequence from Petunia hybrida epsps gene

Validation:

ring trial validation

Standardisation:

ISO standard

Related Methods:

QT-TAX-GM-002

Type:

construct-specific

Target GMO names:

GTS 40-3-2
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RR1-F
  • Sequence:

    CATTTGGAGAGGACACGCTGA
  • Size:

    21
  • Reverse Primer

  • Name:

    RR1-R
  • Sequence:

    GAGCCATGTTGTTAATTTGTGCC
  • Size:

    23
  • Probe

  • Name:

    RR1
  • Sequence:

    CAAGCTGACTCTAGCAGATCTTTC
  • Size:

    24
  • Amplicon:

  • Sequence:

    catttggagaggacacgctgacaagctgactctagcagatctttcnnnnnnggcacaaattaacaacatggctc
  • Size:

    74

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QT-CON-00-003Link to the document url. EU reference method protocol
Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods ISO 21570:1-103 (2005)Link to the document url. other document