Help icon

Detection Image Detection method details

Name:

QL-TAX-ZM-002

Description:

Qualitative real-time PCR (SYBRGreen) method for detection of maize alcoholdeydrogenase 1 gene (Barbau-Piednoir et al., 2014)

Comment:

Target is the endogenous alcohol dehydrogenase 1 (adh1) gene of Zea mays

Validation:

ring trial validation

Standardisation:

unknown

Related Methods:

Type:

taxon-specific

Target Species name:

Zea mays
  • Oligonucleotides:

  • Forward Primer

  • Name:

    ADH_alt Fwd
  • Sequence:

    TCTCTTCCTCCTTTAGAGCTACCACTA
  • Size:

    27
  • Reverse Primer

  • Name:

    ADH_alt Rev
  • Sequence:

    AATCGATCCAAAGCGAGATGA
  • Size:

    21
  • Amplicon:

  • Sequence:

    tctcttcctcctttagagctaccactannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcatctcgctttggatcgatt
  • Size:

    83

Documents

Citation Type Local copy
Barbau-Piednoir, E., Stragier, P., Roosens, N., Mazzara, M., Savini, C., Van den Eede, G., Van den Bulcke, M. (2014). Inter-laboratory testing of GMO detection by combinatory SYBR®Green PCR screening (CoSYPS). Food Analytical Methods. 7, 1719-1728.Link to the document url. peer-reviewed article
EU-RL GMFF GMOMETHODS database; QL-TAX-ZM-002Link to the document url. EU reference method protocol
Mbongolo Mbella, E.G., Lievens, A., Barbau-Piednoir, E., Sneyers, M., Leunda-Casi, A., Roosens, N., Van den Bulcke, M. (2011). SYBR Green qPCR methods for detection of endogenous reference genes in commodity crops: a step ahead in combinatory screening of genetically modified crops in food and feed products. Eur Food Res Technol, 232, 485–496.Link to the document url. peer-reviewed article 27-10-2015