Help icon

Detection Image Detection method details

Name:

QL-TAX-FMVorf7-F4/FMVorf7-R4

Description:

Qualitative real-time PCR (TaqMan) method for detection of orf7 from figwort mosaic virus (Moor et al., 2012)

Comment:

target is the open reading frame VII (orf7) sequence of the figwort mosaic virus (FMV) genome

Validation:

in-house validation

Standardisation:

national standard

Related Methods:

Type:

taxon-specific

Target Species name:

Figwort mosaic virus
  • Oligonucleotides:

  • Forward Primer

  • Name:

    FMVorf7-F4
  • Sequence:

    tatgctaggcttaacgggcttc
  • Size:

    22
  • Reverse Primer

  • Name:

    FMVorf7-R4
  • Sequence:

    ggatccgagattttcttgaagtt
  • Size:

    23
  • Probe

  • Name:

    FMVorf7-FAM probe
  • Sequence:

    tcatctccaagcgagaatttcagctgtttc
  • Size:

    30
  • Amplicon:

  • Sequence:

    -
  • Size:

    113

Documents

Citation Type Local copy