Help icon

Detection Image Detection method details

Name:

QL-TAX-CP-001

Description:

Qualitative conventional PCR method for detection of the chymopapain (chy) gene from papaya (EU-RL GMFF GMOMETHODS database as of May 23, 2016)

Comment:

Target is the endogenous chymopapain (chy) gene from papaya (Carica papaya)

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

QL-CON-00-012

Type:

taxon-specific

Target Species name:

Carica papaya
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Chy-1F
  • Sequence:

    atctacaatcttgctaacccta
  • Size:

    22
  • Reverse Primer

  • Name:

    Chy-2R
  • Sequence:

    agtcatcttgagaataacccac
  • Size:

    22
  • Amplicon:

  • Sequence:

    atctacaatcttgctaaccctaaaatgacggtgcaagtagagtgaatgacaagatcttttatttagagagaaagaaacttgattgaaaagacaagctagtatataaacccatgcggatcctcccatttcccttcatccattcccactcttgagagttagctagtgttacaatggctacgatgagttcaatttcaaaaattattttcttggcaacatgtctcattattcatatgggtttgtcttctgctgatttttacaccgtgggttattctcaagatgact
  • Size:

    282

Documents

Citation Type Local copy
EU-RL GMFF GMOMETHODS database; QL-TAX-CP-001Link to the document url. EU reference method protocol 23-05-2016