Help icon

Detection Image Detection method details

Name:

QL-TAX-Acc1-F/Acc1-R

Description:

Quanlitative real-time PCR (TaqMan) method for detection of alfalfa (Guertler et al. 2018)

Comment:

Target is the endogenous acetyl CoA carboxylase (acc1) of Medicago sativa

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

Type:

taxon-specific

Target Species name:

Medicago sativa
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Acc1-F
  • Sequence:

    gATCAgTgAACTTCgCAAAgTAC
  • Size:

    23
  • Reverse Primer

  • Name:

    Acc1-R
  • Sequence:

    CAACgACgTgAACACTACAAC
  • Size:

    21
  • Probe

  • Name:

    Acc1-P
  • Sequence:

    TgAATgCTCCTgTgATCTgCCCATgC
  • Size:

    26
  • Amplicon:

  • Sequence:

    GATCAGTGAACTTCGCAAAGTACTCGGTTAGTAGACAGTGAATGCTCCTGTGATCTGCCCATGCACTCATGTTGTAGTGTTCACGTCGTTG
  • Size:

    91

Documents

Citation Type Local copy
Guertler et al., Development of event-specific qPCR detection methods for genetically modified alfalfa events J101, J163 and KK179. Biomolecular Detection and Quantification 2019, 17, 100076.Link to the document url. peer-reviewed article 29-04-2019