Help icon

Detection Image Detection method details

Name:

QL-EVE-SQ0718/SQ0719

Description:

Qualitative real-time PCR (TaqMan) method for detection of wheat event MON71800 (verification report of the EU-RL GMFF, 4 Dec 2013)

Comment:

target is the region spanning the insert-to-plant junction in wheat event MON71800. The probe is labelled with a MGB-NFQ (minor groove binding non-fluorescent quencher) as quencher at its 3’ end.

Validation:

in-house validation

Standardisation:

none

Related Methods:

QT-TAX-wx012-5'/wx012-3'

Type:

event-specific

Target GMO name:

MON71800
  • Oligonucleotides:

  • Forward Primer

  • Name:

    SQ0718
  • Sequence:

    ttcttctctctctttgaatctcaatacaa
  • Size:

    29
  • Reverse Primer

  • Name:

    SQ0719
  • Sequence:

    cccccatttggacgtgaa
  • Size:

    18
  • Probe

  • Name:

    PB0101
  • Sequence:

    tccccctctctaattc
  • Size:

    16
  • Amplicon:

  • Sequence:

    ttcttctctctctttgaatctcaatacaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttcacgtccaaatggggg
  • Size:

    95

Documents

Citation Type Local copy
Report on the Verification of the Performance of a Method for the Detection of Event MON71800 in Wheat Using Real-Time PCR (EURL-GMFF 4 Dec 2013)Link to the document url. EU reference method protocol 18-08-2016