Help icon

Detection Image Detection method details

Name:

QL-EVE-CP-001

Description:

Qualitative conventional PCR method for the detection of papaya event Huanong No. 1 (EU-RL GMFF GMOMETHODS database as of September 19, 2016)

Comment:

Target is the 5' integration border region (IBR) between the insert of papaya event Huanong No. 1 and the papaya host genome

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

event-specific

Target GMO name:

Huanong No. 1
  • Oligonucleotides:

  • Forward Primer

  • Name:

    HN-F
  • Sequence:

    ATTGACGAGTACAAGGAGACGC
  • Size:

    22
  • Reverse Primer

  • Name:

    HN-R
  • Sequence:

    CTCCGCTCATGATCAGATTGT
  • Size:

    21
  • Probe

  • Name:

  • Sequence:

  • Size:

  • Amplicon:

  • Sequence:

    attgacgagtacaaggagacgccttttaatttgtttaaattaaataaaaacataaattattaagcgacgtaataataaacacgtcataaattttttcaaaaaataaaatttcttttattttctaaaaagtagttgattcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagctgcgcaaggaacgcccgtcgtggccagccacgatagcctcaaacactgatagtttaaactgaaggcgggaaacgacaatctgatcatgagcggag
  • Size:

    285

Documents

Citation Type Local copy
Wei, J. et al. (2016). Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1. Food Chemistry, 194, 20-25.Link to the document url. peer-reviewed article 14-10-2016