Detection Image Detection method details

  • Name:

    QL-EVE-558F/558R
  • Description:

    Qualitative real-time PCR (TaqMan) method for detection of Bacillus subtilis isolate e871 (Paracchini et al., 2017)
  • Comment:

    Target is the integration site between the inserted cat gene and the endogenousrecA gene of Bacillus subtilis
  • Validation:

    unknown
  • Standardisation:

    none
  • Help icon

    Related Methods:

  • Type:

    event-specific
  • Target GMO name:

    e871 Bacillus subtilis
  • Oligonucleotides:

  • Forward Primer

  • Name:

    558-F
  • Sequence:

    cgagcttttgcgcgtata
  • Size:

    18
  • Reverse Primer

  • Name:

    558-R
  • Sequence:

    gccattccaatacaaaaccacata
  • Size:

    24
  • Probe

  • Name:

    558-Tm
  • Sequence:

    cggatctaacgcatgctccgca
  • Size:

    22
  • Amplicon:

  • Sequence:

    cgagcttttgcgcgtataccggatctaacgcatgctccgcatcgattataggtatgtggttttgtattggaatggc
  • Size:

    76

Documents

Citation Type Local copy