Help icon

Detection Image Detection method details

Name:

QL-EVE-319FalF/320FalR

Description:

Qualitative real-time PCR (TaqMan) method for detection of oilseed rape event Falcon GS40/90 (integration locus 2 – Falcon) (BVL G30.40-6)

Comment:

Target is the integration border region (IBR) between the insert of oilseed rape event Falcon GS40/90 and the rapeseed host genome (integration locus 2 – Falcon)

Validation:

ring trial validation

Standardisation:

national standard

Related Methods:

QT-TAX-BN-012

Type:

event-specific

Target GMO name:

Falcon GS 40/90
  • Oligonucleotides:

  • Forward Primer

  • Name:

    319FalF
  • Sequence:

    tgcggccaagctcaggat
  • Size:

    18
  • Reverse Primer

  • Name:

    320FalR
  • Sequence:

    ttttgactcatatacccttttgcaaa
  • Size:

    20
  • Probe

  • Name:

    321FaIS
  • Sequence:

    agattgtcgtttcccgccttcggttt
  • Size:

    26
  • Amplicon:

  • Sequence:

    tgcggccaagctcatgatcagattgtcgtttcccgccttcggtttaaactatcagtgtttgcaaaagggtatatgagtcaaaa
  • Size:

    83

Documents

Citation Type Local copy
Real-time PCR detection of genetically modified oilseed rape lines Falcon GS40/90 and Liberator pHoe6/Ac - event-specific methods. BVL Official Method Collection G 30.40-06 Online Publication (2013)Link to the document url. other document 04-05-2016