Detection Image Detection method details

  • Name:

    QL-EVE-18-2-4RB-F/18-2-4RB-R
  • Description:

    Qualitative real-time PCR (TaqMan) method for detection of papaya event 18-2-4 (Prins et al., 2016)
  • Comment:

    Target is the 3' integration border region (IBR) between the insert of papaya event 18-2-4 and the papaya host genome.

    The nucleotide sequences of the 309 bp spanning the Right Border of event 18-2-4 is given in GenBank KU376439.

  • Validation:

    unknown
  • Standardisation:

    none
  • Help icon

    Related Methods:

  • Type:

    event-specific
  • Target GMO name:

    18-2-4
  • Oligonucleotides:

  • Forward Primer

  • Name:

    18-2-4RB-F
  • Sequence:

    AGGAGACGACGACAA
  • Size:

    15
  • Reverse Primer

  • Name:

    18-2-4RB-R
  • Sequence:

    TCTCCGCTCATGATCA
  • Size:

    16
  • Probe

  • Name:

    18-2-4RB-P
  • Sequence:

    ATTGTCGTTTCCCGCCTTCAG
  • Size:

    21
  • Amplicon:

  • Sequence:

    AGGAGACGACGACAAAAATAGTAGTAGTGATGAAGAAAATAACAAAATAACAATTATGAGAACAAAGTGATGATAACATCAATAACAAATTAATAAATAATAAGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGA
  • Size:

    152

Documents

Citation Type Local copy
Prins TW, Scholtens IMJ, Bak AW, van Dijk JP, Voorhuijzen MM, Laurensse EJ, Kok EJ. (2016) A case study to determine the geographical origin of unknown GM papaya in routine food sample analysis, followed by identification of papaya events 16-0-1 and 18-2-4. Food Chemistry 213:536–544Link to the document url. peer-reviewed article 18-08-2016