Help icon

Detection Image Detection method details

Name:

QL-ELE-npt 1-5'/npt 1-3'

Description:

Qualitative real-time PCR (TaqMan) method for detection of the nptII gene (Scholtens et al., 2013)

Comment:

target is the neomycin phosphotransferase II (nptII) gene from bacterium Escherichia coli

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-nptII-ECOLX, V-nptII-ECOLX
  • Oligonucleotides:

  • Forward Primer

  • Name:

    npt 1-5'
  • Sequence:

    gacaggtcggtcttgacaaaaag
  • Size:

    23
  • Reverse Primer

  • Name:

    npt 1-3'
  • Sequence:

    gaacaagatggattgcacgc
  • Size:

    20
  • Probe

  • Name:

    nptII-probe
  • Sequence:

    tgcccagtcatagccgaatagcctctcca
  • Size:

    29
  • Amplicon:

  • Sequence:

    gacaggtcggtcttgacaaaaagaaccgggcgcccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagcggccggagaacctgcgtgcaatccatcttgttc
  • Size:

    155

Documents

Citation Type Local copy
Matsuoka T, Kuribara H, Takubo K, Akiyama H, Miura H, Goda Y, Kusakabe Y, Isshiki K, Toyoda M, Hino A (2002) Detection of recombinant DNA segments introduced to genetically modified maize (*Zea mays*). J Agric Food Chem 50, 2100-2109Link to the document url.