Help icon

Detection Image Detection method details

Name:

QL-ELE-cry3A-F/cry3A-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the cry3A, the modified mcry3A, the cry3A083, the cry3A085 and the chimaera cry3A/cry1Ab gene (Prins et al., 2016)

Comment:

target is the cry3A gene from bacterium Bacillus thuringiensis subsp. kumamotoensis (amplicon sequence taken from GenBank DI157749.1; MIR604 maize).

Validation:

in-house validation

Standardisation:

national standard

Related Methods:

Type:

element-specific

Target DNA element:

CS-mcry3A-SYNTH, CS-cry3A-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cry3A-F
  • Sequence:

    cagcaacatcgagaacta
  • Size:

    18
  • Reverse Primer

  • Name:

    cry3A-R
  • Sequence:

    ctccagtagttgaagctg
  • Size:

    18
  • Probe

  • Name:

    cry3A-P
  • Sequence:

    tgttcgactacctgcaccgc
  • Size:

    20
  • Amplicon:

  • Sequence:

    cagcaacatcgagaactacatccgcaagccccacctgttcgactacctgcaccgcatccagttccacacgcgtttccagcccggctactacggcaacgacagcttcaactactggag
  • Size:

    117

Documents

Citation Type Local copy
Prins, T.W., van Hoof, R.A., Scholtens, I.M.J., Kok, E.J. (2016). Novel TaqMan PCR screening methods for element cry3A and construct gat/T‑pinII to support detection of both known and unknown GMOs. Eur Food Res Technol, 243, 481–488.Link to the document url. peer-reviewed article 18-08-2016pdf