Help icon

Detection Image Detection method details

Name:

QL-ELE-cry1A.105 - F1/cry1A.105 - R1

Description:

Qualitative real-time PCR (TaqMan) method for detection of the cry1A.105 gene (Dinon et al. 2011)

Comment:

target is the synthetic cry1A.105 gene

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry1A_105-SYNTH
  • Oligonucleotides:

  • Forward Primer

  • Name:

    cry1A.105 - F1
  • Sequence:

    tcagaggtccagggtttacagg
  • Size:

    22
  • Reverse Primer

  • Name:

    cry1A.105 - R1
  • Sequence:

    gtagtagaggcatagcggattcttg
  • Size:

    25
  • Probe

  • Name:

    cry1A.105 - P
  • Sequence:

    agacattcttcgtcgcacaagtggaggacc
  • Size:

    30
  • Amplicon:

  • Sequence:

    tcagaggtccagggtttacaggaggagacattcttcgtcgcacaagtggaggaccctttgcttacactattgttaacatcaatggccaattgccccaaaggtatcgtgcaagaatccgctatgcctctactac
  • Size:

    133

Documents

Citation Type Local copy
Dinon, A. Z., T. W. Prins, et al. (2011). Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms." Analytical and Bioanalytical Chemistry 400(5): 1433-1442.Link to the document url.