Help icon

Detection Image Detection method details

Name:

QL-ELE-T-g7-F/T-g7-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the g7 terminator from Agrobacterium tumefaciens (Debode et al., 2013)

Comment:

Target is the Agrobacterium tumefaciens g7 terminator (T-g7)

T-g7 (aka T-transcript7 or T-tr7) also recognises ORF23 of Agrobacterium tumefaciens since this is encoded by the reverse strand of T-g7.

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

T-transcript 7
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T-g7-F
  • Sequence:

    ATGCAAGTTTAAATTCAGAAATATTTCAA
  • Size:

    29
  • Reverse Primer

  • Name:

    T-g7-R
  • Sequence:

    ATGTATTACACATAATATCGCACTCAGTCT
  • Size:

    30
  • Probe

  • Name:

    T-g7-P
  • Sequence:

    ACTGATTATATCAGCTGGTACATTGCCGTAGATGA
  • Size:

    35
  • Amplicon:

  • Sequence:

    -
  • Size:

    97

Documents

Citation Type Local copy