Help icon

Detection Image Detection method details

Name:

QL-ELE-T-OCS-F/T-OCS-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of octopine synthase terminator of Agrobacterium tumefaciens (Debode et al., 2013)

Comment:

Target is the octopine synthase terminator (T-OCS) from Agrobacterium tumefaciens.

There are two nucleotides missing in the reverse primer. The amplicon given is the actual sequence generated from Agrobacterium tumefaciens (GenBank: CP011249.1) T-OCS-R: CGCTCGGTGTCGTAGATACT (Debode et al., 2013) T-OCS-R: CGCTCGGTGTGTCGTAGATACT (corrected)

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

T-ocs-RHIRD
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T-OCS-F
  • Sequence:

    CGGTCAAACCTAAAAGACTGATTACA
  • Size:

    26
  • Reverse Primer

  • Name:

    T-OCS-R
  • Sequence:

    CGCTCGGTGTCGTAGATACT
  • Size:

    20
  • Probe

  • Name:

    T-OCS-P
  • Sequence:

    TCTTATTCAAATTTCAAAAGTGCCCCAGGG
  • Size:

    30
  • Amplicon:

  • Sequence:

    CGGTCAAACCTAAAAGACTGATTACATAAATCTTATTCAAATTTCAAAAGTGCCCCAGGGGCTAGTATCTACGACACACCGAGCG
  • Size:

    85

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015