Help icon

Detection Image Detection method details

Name:

QL-ELE-T-35S-F/T-35S-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the 35S terminator from Cauliflower mosaic virus (Debode et al., 2013)

Comment:

Target is the Cauliflower mosaic virus 35S terminator (T-35S CaMV).

The GMOs T25, TC1507, and DAS59122 contain the amplicon which can be found below and therefore can be detected with the described method. However, other GMO events such as Bt176 and Event 3272 cannot be detected with this method since they have a very short version of the T-35S CaMV that does not cover the amplicon.

The amplicon below is generated by amplification on rice LLrice62 (GenBank: JX139719.1) (Debode et al., 2013)

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

T-35S CaMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T-35S-F
  • Sequence:

    AGGGTTTCTTATATGCTCAACACATG
  • Size:

    26
  • Reverse Primer

  • Name:

    T-35S-R
  • Sequence:

    TCACCAGTCTCTCTCTACAAATCTATCAC
  • Size:

    29
  • Probe

  • Name:

    T-35S-P
  • Sequence:

    AAACCCTATAAGAACCCTAATTCCCTTATCTGGGA
  • Size:

    35
  • Amplicon:

  • Sequence:

    agggtttcttatatgctcaacacatgagcgaaaccctataagaaccctaattcccttatctgggaactactcacacattattatagagagagatagatttgtagagagagactggtga
  • Size:

    118

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015