Help icon

Detection Image Detection method details

Name:

QL-ELE-RERIO 2206/RERIO 2207

Description:

Qualitative conventional PCR method for detection of the modified red fluorescent protein (DsRed2) marker gene (Rehbein & Bogerd, 2007)

Comment:

Target is the modified red fluorescent protein (DsRed2) gene from Discosoma sp. (sequence in pDsRed2 vector of Clontech, see GenBank EA057759.1)

Validation:

unknown

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-DsRed2 fluorescent protein
  • Oligonucleotides:

  • Forward Primer

  • Name:

    RERIO 2206
  • Sequence:

    acaacaccgtgaagctgaaggtgaccaag
  • Size:

    29
  • Reverse Primer

  • Name:

    RERIO 2207
  • Sequence:

    ggtgtagtcctcgttgtgggaggtgatgtc
  • Size:

    30
  • Amplicon:

  • Sequence:

    acaacaccg tgaagctgaa ggtgaccaag ggcggccccc tgcccttcgc ctgggacatc ctgtcccccc agttccagta cggctccaag gtgtacgtga agcaccccgc cgacatcccc gactacaaga agctgtcctt ccccgagggc ttcaagtggg agcgcgtgat gaacttcgag gacggcggcg tggcgaccgt gacccaggac tcctccctgc aggacggctg cttcatctac aaggtgaagt tcatcggcgt gaacttcccc tccgacggcc ccgtgatgca gaagaagacc atgggctggg aggcctccac cgagcgcctg tacccccgcg acggcgtgct gaagggcgag acccacaagg ccctgaagct gaaggacggc ggccactacc tggtggagtt caagtccatc tacatggcca agaagcccgt gcagctgccc ggctactact acgtggacgc caagctggac atcacctccc acaacgagga ctacacc
  • Size:

    506

Documents

Citation Type Local copy
H. Rehbein & J. Bogerd (2007) Identification of Genetically Modified Zebrafish (Danio rerio) by Protein- and DNA-Analysis. J. Verbr. Lebensm. 2:122-125Link to the document url. peer-reviewed article 04-11-2016