Help icon

Detection Image Detection method details

Name:

QL-ELE-P-Ubi-F/P-Ubi-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of ubiquitin promoter of Zea mays (Debode et al., 2013)

Comment:

Target is the ubiquitin promoter (P-ubi) from Zea mays

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

P-ubi1-MAIZE
  • Oligonucleotides:

  • Forward Primer

  • Name:

    P-Ubi-F
  • Sequence:

    GAGTAGATAATGCCAGCCTGTTAAAC
  • Size:

    26
  • Reverse Primer

  • Name:

    P-Ubi-R
  • Sequence:

    ACGCGACGCTGCTGGTT
  • Size:

    17
  • Probe

  • Name:

    P-Ubi-P
  • Sequence:

    CGTCGACGAGTCTAACGGACACCAAC
  • Size:

    26
  • Amplicon:

  • Sequence:

    GAGTAGATAATGCCAGCCTGTTAAACGCCGTCGACGAGTCTAACGGACACCAACCAGCGAACCAGCAGCGTCGCGT
  • Size:

    76

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015