Help icon

Detection Image Detection method details

Name:

QL-ELE-P-Rice actin-F/P-Rice actin-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of rice actin 1 promoter (P-ractI) (Debode et al. 2013).

Comment:

Target is the actin 1 promoter from rice (Oryza sativa)

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

P-act1-ORYSA
  • Oligonucleotides:

  • Forward Primer

  • Name:

    P-Rice actin-F
  • Sequence:

    TCGAGGTCATTCATATGCTTGAG
  • Size:

    23
  • Reverse Primer

  • Name:

    P-Rice actin-R
  • Sequence:

    TTTTAACTGATGTTTTCACTTTTGACC
  • Size:

    27
  • Probe

  • Name:

    P-Rice actin-P
  • Sequence:

    AGAGAGTCGGGATAGTCCAAAATAAAACAAAGGTA
  • Size:

    35
  • Amplicon:

  • Sequence:

    TCGAGGTCATTCATATGCTTGAGAAGAGAGTCGGGATAGTCCAAAATAAAACAAAGGTAAGATTACCTGGTCAAAAGTGAAAACATCAGTTAAAA
  • Size:

    95

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015