Help icon

Detection Image Detection method details

Name:

QL-ELE-P-FMV-F/P-FMV-R

Description:

Qualitative real-time PCR (TaqMan) method for detection of the P-FMV promoter (Debode et al., 2013)

Comment:

Target is the 34S promoter from FMV.

In some GMOs that only contain the E-FMV, this method also detects the GMO (e.g. soybean MON89788 and MON87705, canola MON88302 and cotton MON88913).

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

P-FMV
  • Oligonucleotides:

  • Forward Primer

  • Name:

    P-FMV-F
  • Sequence:

    CGAAGACTTAAAGTTAGTGGGCATCT
  • Size:

    26
  • Reverse Primer

  • Name:

    P-FMV-R
  • Sequence:

    TTTTGTCTGGTCCCCACAA
  • Size:

    19
  • Probe

  • Name:

    P-FMV-P
  • Sequence:

    TGAAAGTAATCTTGTCAACATCGAGCAGCTGG
  • Size:

    32
  • Amplicon:

  • Sequence:

    CGAAGACTTAAAGTTAGTGGGCATCTTTGAAAGTAATCTTGTCAACATCGAGCAGCTGGCTTGTGGGGACCAGACAAAA
  • Size:

    79

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015