Help icon

Detection Image Detection method details

Name:

QL-ELE-Cry1F-F2/Cry1Fr-n2

Description:

Qualitative real-time PCR (TaqMan) method for detection of the cry1F gene (Scholtens et al., 2013, with minor modifications in forward primer and probe sequence)

Comment:

Target is the cry1F gene from bacterium Bacillus thuringiensis var. aizawai.

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-cry1F-BACTU
  • Oligonucleotides:

  • Forward Primer

  • Name:

    Cry1F-F2
  • Sequence:

    GACGTGGATCTTCATCTGCAATC
  • Size:

    23
  • Reverse Primer

  • Name:

    Cry1Fr-n2
  • Sequence:

    GCAACACGGCTGGCAATCG
  • Size:

    19
  • Probe

  • Name:

    Cry1F-P2
  • Sequence:

    CGCCCCCGGGATTGAAGACCCCGTAAC
  • Size:

    27
  • Amplicon:

  • Sequence:

    GACGTGGATCTTCATCTGCAATCCAGATGGCGCCCCCGGGATTGAAGACCCCGTAACTAGGAAAGTTGATACGATTGCCAGCCGTGTTGC
  • Size:

    90

Documents

Citation Type Local copy
Scholtens et al. (2012)