Help icon

Detection Image Detection method details

Name:

QL-ELE-B'nase-F-n4/BNaseR-n3

Description:

Qualitative real-time PCR (TaqMan) method for detection of the barnase gene (Scholtens et al. 2013)

Comment:

target is the barnase gene from bacterium Bacillus amyloliquefaciens

Validation:

in-house validation

Standardisation:

none

Related Methods:

Type:

element-specific

Target DNA element:

CS-barnase
  • Oligonucleotides:

  • Forward Primer

  • Name:

    B'nase-F-n4
  • Sequence:

    tggtaccggttattcaacacg
  • Size:

    21
  • Reverse Primer

  • Name:

    BNaseR-n3
  • Sequence:

    gagggcttgtgcttctgatttt
  • Size:

    22
  • Probe

  • Name:

    BNaseP-n3
  • Sequence:

    gtctgaagataatccgcaaccc
  • Size:

    22
  • Amplicon:

  • Sequence:

    tggtaccggttattcaacacgtttgacggggttgcggattatcttcagacatatcataagctacctgataattacattacaaaatcagaagcacaagccctc
  • Size:

    102

Documents

Citation Type Local copy
Scholtens et al. (2012)