Help icon

Detection Image Detection method details

Name:

QL-ELE-00-024

Description:

Qualitative real-time PCR (TaqMan) method for detection of the terminator of the pea ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) E9 gene (EU-RL GMFF GMOMETHODS database as of January 20, 2017)

Comment:

target is the E9 (T-E9) terminator from pea (Pisum sativum)

Validation:

ring trial validation

Standardisation:

EU reference method

Related Methods:

Type:

element-specific

Target DNA element:

T-rbcS_E9-PEA
  • Oligonucleotides:

  • Forward Primer

  • Name:

    T-E9-F
  • Sequence:

    tgagaatgaacaaaaggaccatatca
  • Size:

    26
  • Reverse Primer

  • Name:

    T-E9-R
  • Sequence:

    tttttattcggttttcgctatcg
  • Size:

    23
  • Probe

  • Name:

    T-E9-P
  • Sequence:

    tcattaactcttctccatccatttccatttcacagt
  • Size:

    36
  • Amplicon:

  • Sequence:

    tgagaatgaacaaaaggaccatatcattcattaactcttctccatccatttccatttcacagttcgatagcgaaaaccgaataaaaa
  • Size:

    87

Documents

Citation Type Local copy
Debode, F., Janssen, E., Berben, G. (2013). Development of 10 new screening PCR assays for GMO detection targeting promoters (pFMV, pNOS, pSSuAra, pTA29, pUbi, pRice actin) and terminators (t35S, tE9, tOCS, tg7). Eur Food Res Technol, 236, 659–669.Link to the document url. peer-reviewed article 17-09-2015